pita02guzman pita02guzman

16-01-2020
Mathematics

contestada

Q5: If the perimeter of the rectangle is 108km.
15 km
12 km

Respuesta :

kwebblekop175 kwebblekop175

16-01-2020

Answer:

yess

Step-by-step explanation:

Answer Link

Otras preguntas

What is the molar mass of sodium carbonate (Na2CO3)?

How can you know if this equation is true? 1/2 + 3/8 = 4/10 = 2/5 1) Because 1+3=4 and 2+8=10, this equation must be true. 2) Because 25<12, this equation c

A triangle has an area of 24 meters squared and base length of 8m. Find the height.

N + (18 - 6) = 32 who can help me?

Although egg-laying is rare in mammals, it is common for other amniotes. The fact that monotremes, such as the platypus, lay eggs A. suggests this is an ancestr

i will give brainliest

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

A spaceship launched into the air has a height (feet) at any given time (seconds) as h=-t^2+10t until it hits the ground. At what time(s) is it at a height of 9

You would like to determine if there is a higher incidence of smoking among women than among men in a neighborhood. Let women and men be represented by populati

Need help solving this math problem. Use synthetic division to show that 5 is a solution of the equation shown below. Then solve the polynomial equation. Hint: