halima72 halima72
  • 04-05-2020
  • History
contestada

Why is the cost of public policies important to consider

Respuesta :

Аноним Аноним
  • 04-05-2020

Answer:

ummmmmmmmmmmmmmmmm

Explanation:

Answer Link
waldengavanna
waldengavanna waldengavanna
  • 04-05-2020
Because it considered strong when it solves problems efficiently and effectively, serves and supports governmental institutions and policies, and encourages active citizenship.
Answer Link

Otras preguntas

What does it mean to evaluate?
PLSSS HELP ASAPP ITS 200 points and I give brainlist Feb 25th and 26th Honors Chemistry Assignment Follow the given steps: Balance the equations. Calculate th
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
GIVING BRAINLIEST Find the surface area of the net below
it is midday at the clinic and sarah......
I NEED IT IN 5 OR LESS MINETS Miranda’s conviction was overturned by the __________ because his Constitutional right to a __________ was violated. A. district c
Help someone help plz
4:08 - 1:15 = time calcuation
these are my finall points im giving outt!! :)
1. Simplify each of the following.(a) 4(6-1)-9​