sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

an ______ is a simplified image. [4 letters]

Solve c for 20 = -2c_______HELP!!

P (x) is a polynomial. Here are a few values of P (x): P(-5)=-2 and P (5)=-1 What is the remainder when P(x) is divided by (x+5)? (Answer choices in the picture

BARACK OBAMA "It was a pleasure to burn. It was a special pleasure to see things eaten, to see things blackened and changed. With the brass nozzle in his fists,

What were the roots of Renaissance

Identify which of the following factors are density-dependent or density-independent.---- Earthquake----- Disease----- Food-----

Select the correct answer from each drop-down menu. A physical map usually uses various colors to represent different features. Some are common on most maps. Fo

Please help ASAP this is due tomorrow

According to the Census Bureau, in October 2016, the average house price in the United States was $354,900. In October 2000, the average price was $215,100. Wha

Based on the graph, at what temperature does this enzyme work best? * Captionless Image 47 C 30 C 40 C 15 C