hyolmolhamu12 hyolmolhamu12
  • 02-10-2020
  • Social Studies
contestada

why respecting women is necessary for reformed society​

Respuesta :

owensuda21
owensuda21 owensuda21
  • 02-10-2020
Because they are nice
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
What is the primary purpose of the Supremacy Clause?
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
How did the mountains in Greece contribute to the rise of city-states?
What is the primary purpose of the Supremacy Clause?
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
4(3-5)=-2(8-z)-6z what is z