i90zkiddd i90zkiddd
  • 04-01-2021
  • Mathematics
contestada

What angles can prove the triangle is congruent?

What angles can prove the triangle is congruent class=

Respuesta :

girigaurab833
girigaurab833 girigaurab833
  • 04-01-2021

angle angle angle axiom

Answer Link

Otras preguntas

Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
How much money, in dollars, does one mole of nickels represent?
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
why is it critical to your cells to be near capillaries
What is the primary purpose of the Supremacy Clause?
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?