djhdjdhddhhshj djhdjdhddhhshj

03-05-2021
Social Studies

contestada

Anybody know this ? If I get it correct I’ll mark u brainliest I promise .

Anybody know this If I get it correct Ill mark u brainliest I promise class=

Respuesta :

dejahn46 dejahn46

23-06-2021

Answer:

ugh

I dont know tho so I have ti wait now

djdjdhshdhshwhshshdhdsjdjdd oh mk

Answer Link

Otras preguntas

The area in a multipolar neuron that connects the cell body to the initial segment of the axon is called the ________.

What are some quotes in macbeth that show he is ambitious?

What contributed to social stratification that developed in the united states in the late 19th century?

why is derek miller's social media post different than most?

Which event in the typical life cycle of sexually reproducing fungi involves transition from a haploid to a diploid stage?

As a result of the educational reforms enacted in 1984, Texas schools offered A. lighter class loads. B. smaller class sizes. C. fewer assessment tests. D

how was the 20th maine regiment so instrumental in winning the Battle of Gettysburg?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

stars and planets are made from gases in a

Jill is interested in understanding the theory that focuses on power in contemporary society. what theory should jill investigate?