anathimzolisa640 anathimzolisa640
  • 02-09-2021
  • Social Studies
contestada

14 Describe how the following concepts could help to fight al social and environmental responsibility social activism social justice​

Respuesta :

clineaileyb
clineaileyb clineaileyb
  • 02-09-2021

Answer: which following concepts?

Answer Link

Otras preguntas

In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
How do you write fifty-seven thousand,eighteen. In standard form
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
who fought against each other in the crusades?
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
How to change 3 7/8 into an improper fraction