nick1096752007 nick1096752007
  • 01-11-2021
  • Physics
contestada

How much force is needed to accelerate a 2,000 kg car at a rate of 9 m/s2?

Respuesta :

Аноним Аноним
  • 05-11-2021

Answer:

[tex]here \: answer[/tex]

F » 18,000 N

Explanation:

Given :

Mass (m) = 2,000 kg

Acceleration (a) = 9 m/s2

To Find :

the formula for force

F = m • a

F = 2,000 • 9

F = 18,000 N

Answer Link

Otras preguntas

Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the temperature of a sample of matter is a measure of the ?
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
Did feudalism create a stable form of government?
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
What statement best describes a republic?
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for