chanda150 chanda150

05-05-2022
Mathematics

contestada

Write an equation in slope-intercept form for the line with slope 5 and y-intercept-3.

Respuesta :

1055666 1055666

05-05-2022

Answer: y = 5x-3

Step-by-step explanation: Using y = mx+b, where m is the slope, and b is the y intercept, you just plug in 5 and -3.

Answer Link

Otras preguntas

According to narrator, who does the Dusk hour belong to ? a. To defeated. b. To poor c. To gostby d. To Stranger.

the traced path of a moving point is the definition of what element of art?

which new instruments were introduced in the different eras

what are The five elements of plot/ storyline in the exact order

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

how should dry rice be stored in a dry storage area

Suppose that you and 100 other people ask 25 randomly selected workers how much money they spent on lunch. Which of the following statements would be true? All

The value of Maggie's car decreased by 30% since last year, when she bought it. If the car is now worth $22,000.00, how much was the car worth when she bought i

Se van a colocar mosaicos de 15m×0.30 m en un espacio que mide 3.2 m2. ¿Cuántos mosaicos completos se colocarán?

which of the following is not a banking term or fee that could result in an additional charge on your checking account?