isamilkey isamilkey
  • 03-11-2017
  • Mathematics
contestada

The first truck in a convoy will carry 12 tons of dirt while each additional truck will carry 8 tons of dirt. Write a rule to model th situation. Then use the rule to find how many tons of dirt can be carried by 7 trucks. Let n represent the number of trucks and t represent the tons of dirt.

Respuesta :

jpohloz2u1x jpohloz2u1x
  • 08-11-2017
12 + 8n = t
 
68 tons of dirt will be hauled
Answer Link

Otras preguntas

In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
what rule does static electricity follow
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how would u form a superlative for the adverb widely
What was George Washington's nickname?
Help pl0x, Algebra 1
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
How do I do trebuchet calculations????? Help me please