Worksmarter5581 Worksmarter5581

03-02-2018
Business

contestada

What is the interest rate on a three-year investment with a future value of $1000 and a present value of $863.84?

Respuesta :

mathmate mathmate

07-02-2018

Use
[tex]F=P(1+i)^n[/tex]

Substituting
F=1000, P=863.84, n=3
solve for i
[tex]1000=863.84^(1+i)^3[/tex]
solving for i
=>
[tex]i=(\frac{1000}{863.84})^{\frac{1}{3}}-1[/tex]
=0.0500

Answer: the annual interest rate is 5%

Answer Link

Otras preguntas

at this rate how many pages does he complete in 200 minuties

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Her gait has also been affected. She reports a recent trip to the woods to go camping as a family. As Nancy is giving you the history, Leah collapses on the flo

A group of students were surveyed about their interest in a new International Studies program. Interest was measured in terms of high, medium, or low. 30 studen

For some material, the heat capacity at constant volume Cv at 34 K is 0.81 J/mol-K, and the Debye temperature is 306 K. Estimate the heat capacity (in J/mol-K)

Which solution shown below contains an error?

how do i solve using the substitution method? x+y=-1 y=-2x

What are eggshells made of?

A 7.80-g bullet moving at 540 m/s strikes the hand of a superhero, causing the hand to move 5.10 cm in the direction of the bullet's velocity before stopping. (

what are the social impacts of the 1965 immigration act