Seudónimo Seudónimo
  • 01-02-2016
  • Social Studies
contestada

what type of song originated with the slaves doing fieldwork in the colonies?

Respuesta :

musicgirl934
musicgirl934 musicgirl934
  • 01-02-2016
The songs were called "Spirituals." They believed that in the songs there were directions on how to reach the underground railroad.
Answer Link
ruthannegauge
ruthannegauge ruthannegauge
  • 01-02-2016
the songs they sang were spirituals that made them remember their family and because of that the jubilee singers became famous for their spiritual "Go Down Moses"
Answer Link

Otras preguntas

In which system of government would states function independently of each other?
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
what are 2 examples of ionic compound?
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
how to i do 7/16÷(31/2÷1/2)
Do all your pet's offspring look the same? If no, then explain why they look different.
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5