mlaqueozffld mlaqueozffld

01-05-2018
English

contestada

True or false? in Macbeth: Duncan announced that he has chosen Ross to be the next king.

Respuesta :

yjobe01 yjobe01

01-05-2018

it's false. Duncan said;"I 'SHALL' announce Ross to be the next king" not "I announced Ross to be next king.
hope it helps

Answer Link

Otras preguntas

How did japan gain territory and control of areas of china during world war 1?

What is the French name for the Hall of Mirrors? What is the Avenue Trianon?

Hallucinogens can cause __________. A. extremely high speed B. slowing down or stopping in the middle of a freeway C. heightened focus on the driving task D. A

The tall woman was a (professional) athlete who always (laughed) during scary movies. Choose the two antonyms for the (bracketed words) expert / chuckled skill

how is mechanical weathering best described A. The buildup of chemical deposits on the surface B. The breakdown of rock through mechanical disintegration and ph

Regents what was a goal of progressive era reforms such as recall, referendum, and the direct primary?

How many 1900 galveston hurricane facts homes and buildings was destroyed?

What’s the missing side?

What is the value of x? x = 2 x = 3 x = 4 x = 6

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat