nrd403 nrd403
  • 04-03-2016
  • History
contestada

Which place was more likely to rely on slave labor?

Respuesta :

Misscia
Misscia Misscia
  • 04-03-2016
I think is a place that is more likely to  rely on slavery

 Africa   
Answer Link

Otras preguntas

Who stepped up as leaders during the French revolution
What characteristic is NOT shared by all living organisms? Group of answer choices
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Answer this pleaseeeeeee
Which of the following events would a person most likely have anticipated when young?" A - a sudden assassination of the President B - a comfortable retirement
Dean brings up the ambiguity branch managers at First National Bank face. He believes senior leadership needs to make it clear what managers' most important pri
if a person died, how do they still have personhood?
Before the advance-purchase deadline, the cost of attending a particular event is $46.32. After that, the price increases 37.5%. What is the cost then?
you can get 20 point for awnsering this question and i will mark brainliest if answered correctly How is success of intrest groups measured A) weather the gover
4. How long will it take a car travelling with a speed of 160 km hr to cover a distance of 700 meters? Hint: km/hr should be converted to m/s​