Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

Patrick ate 3/5 of a small pizza on Friday night. For lunch on Saturday , he ate 1/2 of the leftover pizza. How much pizza did he eat for lunch on Saturday?

Scientists divide rocks into groups based on_________

The positive integer x is a multiple of 9 and also a multiple of 12. The smallest possible value of x is (A) 3 (B) 12 (C) 21 (D) 36 (E) 72

How is the ecological system organized?

Bethany's dog eats 450 grams of food per day. How many kilograms does the dog eat in a week

What's the answer to this problem?

If the probability of giving birth to a boy is 0.52, what is the approximate probability of giving birth to 4 consecutive boys?

Who was Canada's FIRST prime minister.

I forgot what are homophones.Does anyone know what's a homophone.

Given that 500w = 3 * 700, find the value of w.