stepchicken stepchicken

02-09-2020
Geography

contestada

I think this is geography but can someone help PLEASE

I think this is geography but can someone help PLEASE class=

Respuesta :

sheetalbarve333 sheetalbarve333

02-09-2020

Answer:

True

Explanation:

True ggggggdddddnbdqbgmmbnhjgghffff

Answer Link

Otras preguntas

Find the minimum cost of producing 60000 units of a product, where x is the number of units of labor, at $99 per unit, and y is the number of units of capital e

A researcher conducts a study examining the alcohol consumption of college students. She brings the first group of students into the laboratory the week before

what would happen to native american tribes after the war of 1812

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT Question 1 options: 14 and 1

1. What is Lincoln telling the South he would not do?

Read the excerpt from "Tools of the Spymaster." Which statement is best supported by text evidence from the excerpt? General Clinton, concerned about what Gener

A brave child decides to grab onto an already spinning merry‑go‑round. The child is initially at rest and has a mass of 34.5 kg. 34.5 kg. The child grabs and cl

What are the roots of x in -1 2x-9 = 0?

Which of the following is an example of an argument rooted in bias? A. Our company will outperform our competitors because it is the best company ever! O B. Our

What is 1 to 4 and 3 to 12?