Seudónimo Seudónimo
  • 03-09-2020
  • Mathematics
contestada

There are 8 circles and 2 squares. What is the simplest ratio of squares to circles?

Respuesta :

adamspat02 adamspat02
  • 03-09-2020

Answer:

1 square for every 4 circles

1:4

1/4

Step-by-step explanation:

To get it to the simplest ratio all you have to do is put the given numbers (8,2) into fraction form based on the order given in the question. The order given was "squares to circles". This makes squares the numerator and circles the denominator. After you set it into a fraction just reduce the fraction to its simplest form.

Answer Link

Otras preguntas

need the answer for this it’s kinda simple to do but i forgot how to do it.
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Suppose the marginal cost of the 1st hour of talking on the phone is $50, the marginal cost of the 2nd hour is $75, and the marginal cost of the 3rd hour is $10
2A - 5B + 4X = C - 8X
A sphere has a radius of 6 inches. What is the volume of the sphere in terms of π? V = π in.3
Scientific notation (7*10^0) + (3*10^1)
please hurry solve for c in the diagram in the picture!
b. Interpret the Rsquared value. Does the multiple regression equation help us predict the total golf score much better than we could without knowing that​ equa
Is the relation {(-2.2)(3,5)(4,2),(3,-1) a function
List the following four activities in the order they go in the physical activity pyramid from top to bottom. Soccer practice; Homework; walking 30 minutes to sc