sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

plzzzzz help me plz plz plz

What is the measure of arc ECF in circle G? 52° 98° 158° 177°

helpppppppppppppppppppp please

Why when we rest our pulse slows down

Select all the functions whose graphs include the point (3, 12) y=+9 y= 4x y = 2x + 1 y= x2 y= 2x

trigonometry please help! work need to be shown

At the end of the current year, using the aging of receivable method, management estimated that $18,000 of the accounts receivable balance would be uncollectibl

1. The first bus stop on a bus route is 4 miles from school. How many yards is the first bus stop from school? A) 12 yards B) 1760 yards C) 5280 yards D) 7040

Red Blossom Corporation transferred its 40 percent interest to Tea Company as part of a complete liquidation of the company. In the exchange, Red Blossom receiv

The cost c (in dollars) for the fuel and maintenance of a go-cart is given by c=9x+1500, where x is the number of rides. It costs $34 per ride. How many rides d