giovanncisneros7375 giovanncisneros7375

03-03-2021
Mathematics

contestada

The diameter of a circle is 4 ft. Find its area to the nearest tenth.

Respuesta :

milessweaze milessweaze

03-03-2021

Answer:

.09ft^2

Step-by-step explanation:

Answer Link

naomia479 naomia479

11-03-2022

Answer:

12.6 ft^2

Step-by-step explanation:

Answer Link

Otras preguntas

how was the 20th maine regiment so instrumental in winning the Battle of Gettysburg?

From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.

Which country is the world’s largest producer of wheat? USA China Russia France

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How would investment model researchers like rusbult and martz (1995) explain why battered women often return to their abusive partners?

A teratogen is any agent or condition that increases the risk for: select one: a. prenatal abnormalities. b. damage to the placenta. c. extra chromosomes. d. ma

how was the 20th maine regiment so instrumental in winning the Battle of Gettysburg?

What was OPEC protesting when it imposed it's embargo?

If you tell a friend you don't have any money to lend him when in reality you do, you're demonstrating which of the "reasons for lying"?

A guaranteed protection against vague laws is known as which of the following?